lelgenio@lemmy.ml to Memes@lemmy.ml · 1 year agoAACGTCATAGCCTGATTACCAGTAGGTACTAGlemmy.mlimagemessage-square12fedilinkarrow-up1451arrow-down127file-text
arrow-up1424arrow-down1imageAACGTCATAGCCTGATTACCAGTAGGTACTAGlemmy.mllelgenio@lemmy.ml to Memes@lemmy.ml · 1 year agomessage-square12fedilinkfile-text
An image of Mr Krabs saying “Spanchbab me boy.I sequenced me own genome AACGTCATAGCCTGATTACCAGTAGGTACTAG”
minus-squareGruxx@kbin.sociallinkfedilinkarrow-up19·1 year agoUgh it didn’t blast or translate EMBOSS_001_1 NVIALPVGTX EMBOSS_001_2 TSPDYQVLX EMBOSS_001_3 RHSLITSRY EMBOSS_001_4 STYW*SGYDV EMBOSS_001_5 YLLVIRLRX EMBOSS_001_6 LVPTGNQAMTX
minus-squareTauZero@mander.xyzlinkfedilinkarrow-up3·1 year agoOut of the loop - what is the joke supposed to be? If this is neither a real sequence nor a hidden message. Is it something Krusty Krab says in the show? Is it just funny because it is absurd?
minus-squareGlifted@lemmy.worldlinkfedilinkarrow-up10·1 year agoIf “reading” the sequence, it sounds similar to Mr Krab’s laugh
minus-squareapotheotic(she/they)@beehaw.orglinkfedilinkarrow-up7·1 year agoMr Krabs laughs very distinctly, and it sort of sounds like it would be spelt like the genome in the OP. Check it out on yt or something, should help
Ugh it didn’t blast or translate
Out of the loop - what is the joke supposed to be? If this is neither a real sequence nor a hidden message. Is it something Krusty Krab says in the show? Is it just funny because it is absurd?
If “reading” the sequence, it sounds similar to Mr Krab’s laugh
Mr Krabs laughs very distinctly, and it sort of sounds like it would be spelt like the genome in the OP. Check it out on yt or something, should help